Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for HAND1-TCF3
HAND1-TCF3
jaspar_core
TFBS logo for NEUROD1_MOUSE/TCF3_MOUSE
NEUROD1_MOUSE/TCF3_MOUSE
Diabetes
Overview

E2A proteins bind DNA at the “E-box” consensus sequence CANNTG. E-boxes were originally identified within the prototypic intronic enhancer elements associated with the immunoglobulin heavy and kappa light genes [1]. Consistent with the role of E2A proteins in multiple tissues, E-boxes are additionally present in a number of non-lymphoid genes.

References
  1. Murre C et al. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell, 56(5):777-83. (PMID 2493990)
    Binding site profiles
    About this section
    These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
    JASPAR profile
    Pazar TFIDSpeciesTF NamePazar Project
    TF0000066NoneHAND1-TCF3jaspar_core

    LogoPFMSites
    877_ENSMUST00000105346_TF0000066.png
     ACGTA
    A
      C
    C
      G
    G
      T
    T
    1100172
    A
    C
    G
    T
    212026
    A
    C
    G
    T
    322610
    A
    C
    G
    T
    400029
    A
    C
    G
    T
    500290
    A
    C
    G
    T
    604241
    A
    C
    G
    T
    7101315
    A
    C
    G
    T
    8151310
    A
    C
    G
    T
    965414
    A
    C
    G
    T
    1045416
    A
    C
    G
    T
      Sequence Gene TF or TF complex Pazar sequence
    1 GTGGTATAAGCGTCTGGCATTCTC 24
    Artificial constructCO0002458
    2 GTAGTGTAAGGATCTGGCATTCTTTG 26
    Artificial constructCO0002459
    3 CGTGGGGGTGGATCTGGCATTCGTTG 26
    Artificial constructCO0002460
    4 ACCACCCACATGTCTGGCATTTTTTC 26
    Artificial constructCO0002461
    5 CATGTGGTCTGGCAATGCGTT 21
    Artificial constructCO0002462
    6 TAGCTCAGGTCTGGCAAATCGCC 23
    Artificial constructCO0002463
    7 CGCGCGTCTGGATTGTCGGC 20
    Artificial constructCO0002464
    8 CATCTGGATTCCAGAG 16
    Artificial constructCO0002465
    9 AGGAGGAGTGATCTGGATTTTCACA 25
    Artificial constructCO0002466
    10 GGTGTCTGGTATCACGAA 18
    Artificial constructCO0002467
    11 GGCAATATGATGTCTGGATTTTGGCA 26
    Artificial constructCO0002468
    12 ACGAGTAGGGTATCTGGCAGCAATGG 26
    Artificial constructCO0002469
    13 CATCTGGATCGGGGCA 16
    Artificial constructCO0002470
    14 TACAGATAAGTGTCTGCAATCATCCA 26
    Artificial constructCO0002471
    15 TATGGATCTGGTTTCTGGTT 20
    Artificial constructCO0002472
    16 ATGTGTCTGGTTTATGGAT 19
    Artificial constructCO0002473
    17 GAAGAATGGCAGTCTGCCAAGTATGA 26
    Artificial constructCO0002474
    18 GAGTTTCGTGTGTCTGGAGTTACATT 26
    Artificial constructCO0002475
    19 TTGATAATAGAGTCTGGTTTTTTGTG 26
    Artificial constructCO0002476
    20 GAGAGAACGGCACCTGGCACGGTTCC 26
    Artificial constructCO0002477
    21 GGACAATGGGCGTCTGGTTAATGTGT 26
    Artificial constructCO0002478
    22 CATACTGGCATACGTCC 17
    Artificial constructCO0002479
    23 GGTTCTCTCTCACCTGGCAGTCAGCT 26
    Artificial constructCO0002480
    24 ATGGGATTGTGGTCTGGAGGAGTGCG 26
    Artificial constructCO0002481
    25 CATATGGAGCTGGCAG 16
    Artificial constructCO0002482
    26 GGTGTTGGTAATACTGGCACTTAGCC 26
    Artificial constructCO0002483
    27 TGCTATGCGACGTCTGCGAATCGGGG 26
    Artificial constructCO0002484
    28 CTTGCAAGGGGTTCTGTATCTAA 23
    Artificial constructCO0002485
    29 GTGGTTTTGGCGTGTGGCCAT 21
    Artificial constructCO0002486
     
    Other profiles
    Pazar TFIDSpeciesTF NamePazar Project
    TF0000930NoneNEUROD1_MOUSE/TCF3_MOUSEDiabetes

    LogoPFMSites
    877_ENSMUST00000105346_TF0000930.png
     ACGTA
    A
      C
    C
      G
    G
      T
    T
    10802
    A
    C
    G
    T
    210000
    A
    C
    G
    T
    30307
    A
    C
    G
    T
    40802
    A
    C
    G
    T
    500010
    A
    C
    G
    T
    62080
    A
    C
    G
    T
    70900
    A
    C
    G
    T
    80306
    A
    C
    G
    T
      Sequence Gene TF or TF complex Pazar sequence
    1 CCCTCAGGTACATCTGCCGCACCTACCG 28
    INSM1 (mouse)NEUROD1_MOUSE/TCF3_MOUSERS0153464
    2 AGAACAGAAAGTAAATAAG 19
    Pdx1 (mouse)NEUROD1_MOUSE/TCF3_MOUSERS0153465
    3 TGGAAACTGCAGCTTCAGCCCCTCTGGCCA 30
    TCTGCTGATCCA 42
    INS2 (rat)NEUROD1_MOUSE/TCF3_MOUSE, Neurod1_MOUSERS0153466
    4 AGCTCGCTCCTTTGGCACACACAAAGCACG 30
    CCAATCCTTCCTACATCCCTCCCAGAGTAG 60
    ATACAATTGCTTTAGCTACGAAGAGCAAGA 90
    GTGCCGGTCCAGCTCGGGATCGCAGCCACT 120
    ACCGCCTGCCGGACAGAGCGGGAACCAACA 150
    GTCAGAAAAGATCAAAGATTCTCACAAAAC 180
    AGCTGGCATGGGTTTAAAATTCACGGACTA 210
    GTAGGAATGCAGAAAAAAGGTATACATTTT 240
    GCTTTCAGAGAGACTTCTGTAACTTCGGCT 270
    TTCCATCC 278
    NNAT (mouse)Neurod1_MOUSE, NEUROD1_MOUSE/TCF3_MOUSERS0153468
    5 TGGAAACTGCAGCTTCAGCCCCTCTGGCCA 30
    TCTGCTGA 38
    INS2 (mouse)NEUROD1_MOUSE/TCF3_MOUSERS0153470
    6 CAAATG 6
    GS0014492 (mouse)NEUROD1_MOUSE/TCF3_MOUSERS0153472
    7 CAGTTGGCAGGTG 13
    GS0014492 (mouse)NEUROD1_MOUSE/TCF3_MOUSERS0153473
    8 ACTTCCTCACTCATGGCACGGAAACGACAA 30
    ATGTGCTGTTTTATTCGTACAATTTATTTC 60
    ATTATTGTTGCCAGCACGAAGCATCACAAT 90
    CAATCATAAGGAAGTCCAGTTGGCAGGTGT 120
    CAATCTTGGTGTGTTTTTGTATGTCTCGGT 150
    CTATATTTAATCCAATTATAAGGGTCACGG 180
    AG 182
    GS0014492 (mouse)NEUROD1_MOUSE/TCF3_MOUSERS0153474
    9 GTGATAGGCACCAAGGCACTGACCTGGGAA 30
    CTAAGCAGGTGGTAATGTCTACCAAGCTGG 60
    CAGTCACTGTGGTGACAGGGTGACAGAGTG 90
    GTCACCATGGTGACAGGAGTAGAGAGGCCT 120
    TTGGCAATCAGTCCCAGTTTTCTGCATGGT 150
    GGCTCTAATGAGACAATGGTCACCATAGAA 180
    ACCACAGGCCCTCCCAGGAGCACAGAGGCC 210
    CTGACAGGAGACATCTACTCCACACCTGGT 240
    TGGAACAGAAGCACC 255
    GCK (mouse)NEUROD1_MOUSE/TCF3_MOUSERS0153475
    10 CCCCTCTGGCCATCTGCTGATCC 23
    INS2 (rat)NEUROD1_MOUSE/TCF3_MOUSERS0153476
     
    Pazar TFIDSpeciesTF NamePazar Project
    TF0000955NoneTCF3Pluripotency

    LogoPFMSites
    MEME could not generate a logo for this dataset.
    MEME could not find a motif in this dataset.
      Sequence Gene TF or TF complex Pazar sequence
    1 CTTTGAT 7
    Nanog (mouse)TCF3RS0153607
     
    Pazar TFIDSpeciesTF NamePazar Project
    TF0000972NoneTCF3 M3Pluripotency

    LogoPFMSites
    MEME could not generate a logo for this dataset.
    MEME could not find a motif in this dataset.
      Sequence Gene TF or TF complex Pazar sequence
    1 CTTTGA 6
    Pou5f1 (mouse)TCF3 M3RS0153624
     
    Pazar TFIDSpeciesTF NamePazar Project
    TF0000978NoneTCF3 M1Pluripotency

    LogoPFMSites
    MEME could not generate a logo for this dataset.
    MEME could not find a motif in this dataset.
      Sequence Gene TF or TF complex Pazar sequence
    1 ACCAAA 6
    Pou5f1 (mouse)TCF3 M1RS0153631