Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for PAX8_MOUSE
PAX8_MOUSE
TFe
TFBS logo for PAX8_HUMAN
PAX8_HUMAN
TFe
Overview
No annotation is available in this section for this article. The content below is taken from a related TF, PAX8 (Homo sapiens).

PAX8 binds to cognate DNA sequences through one DNA binding domain, the paired domain, which is known to be composed of two subdomains (PAI and RED) each recognizing distinct half-sites in adjacent major grooves of the DNA helix. The analysis of PAX8 paired domain mode of binding with its site on the thyroglobulin promoter was performed and it was shown that the PAI and the RED subdomains interact with DNA as a monomer and display a lower binding affinity than the full-length protein suggesting that the interaction occurs through cooperation between the two subdomains [1]. EMSA assays, methylation interference and mutational studies on thyroglobulin and thyroperoxidase promoters revealed that the conserved TGCCCAG/CT motif is important for binding of Pax8, but suggested that the surrounding sequences dictate distinct modes of interaction with the conserved core. In addition in both promoters the binding-site of Pax8 overlaps with that of TTF-1[2] .

References
  1. Pellizzari L et al. Co-operation between the PAI and RED subdomains of Pax-8 in the interaction with the thyroglobulin promoter. Biochem. J., 337 ( Pt 2):253-62. (PMID 9882622)
  1. Zannini M et al. Pax-8, a paired domain-containing protein, binds to a sequence overlapping the recognition site of a homeodomain and activates transcription from two thyroid-specific promoters. Mol. Cell. Biol., 12(9):4230-41. (PMID 1508216)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
Pazar TFIDSpeciesTF NamePazar Project
TF0000831NonePAX8_HUMANTFe

LogoPFMSites
793_ENST00000397647_TF0000831.png
 ACGTA
A
  C
C
  G
G
  T
T
12000
A
C
G
T
22000
A
C
G
T
30020
A
C
G
T
40200
A
C
G
T
50002
A
C
G
T
60002
A
C
G
T
70020
A
C
G
T
82000
A
C
G
T
90110
A
C
G
T
100002
A
C
G
T
110020
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 CGCTTCTTTGAAGCTTGACTGAGTTCTTTC 30
WT1 (human)PAX8_HUMANRS0146187
2 TGATGCCCACTCAAGCTT 18
TPO (mouse)PAX8_HUMAN, PAX8_MOUSE, NKX2-1_MOUSERS0146188
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000832NonePAX8_MOUSETFe

LogoPFMSites
793_ENSMUST00000028355_TF0000832.png
 ACGTA
A
  C
C
  G
G
  T
T
11200
A
C
G
T
20300
A
C
G
T
30201
A
C
G
T
40021
A
C
G
T
50300
A
C
G
T
60300
A
C
G
T
70300
A
C
G
T
80003
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 GTTCCCGCCCTCTTGGAGCC 20
WT1 (mouse)PAX8_MOUSERS0146189
2 ACCTGCCCCTCCCTCCA 17
WT1 (mouse)PAX8_MOUSERS0146190
3 CACTGCCCTGTCAAGTGTCCTTGA 24
TGN (mouse)PAX8_MOUSERS0146191