Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for CLOCK_MOUSE/ARNTL_MOUSE
CLOCK_MOUSE/ARNTL_MOUSE
TFe
Overview

CLOCK:ARNTL heterdimers bind 'canonical' E-boxes (CACGTG), some 'non-canonical' E-boxes (CANNTG)[1], and some E-box like sequences as well (CACGTT of mPer2[2]). Sequences flanking E-boxes also seem to play an important role in determining the DNA binding affinity of CLOCK:ARNTL dimers, which in turn further determines which elements crive rhythmic expression of downstream genes[3].

References
  1. Kiyohara YB et al. Detection of a circadian enhancer in the mDbp promoter using prokaryotic transposon vector-based strategy. Nucleic Acids Res., 36(4):e23. (PMID 18252768)
  2. Yoo SH et al. A noncanonical E-box enhancer drives mouse Period2 circadian oscillations in vivo. Proc. Natl. Acad. Sci. U.S.A., 102(7):2608-13. (PMID 15699353)
  1. Kumaki Y et al. Analysis and synthesis of high-amplitude Cis-elements in the mammalian circadian clock. Proc. Natl. Acad. Sci. U.S.A., 105(39):14946-51. (PMID 18815372)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
Pazar TFIDSpeciesTF NamePazar Project
TF0000885NoneCLOCK_MOUSE/ARNTL_MOUSETFe

LogoPFMSites
582_ENSMUST00000047321_TF0000885.png
 ACGTA
A
  C
C
  G
G
  T
T
12001
A
C
G
T
23000
A
C
G
T
31011
A
C
G
T
40030
A
C
G
T
52010
A
C
G
T
60030
A
C
G
T
70030
A
C
G
T
81002
A
C
G
T
92010
A
C
G
T
100120
A
C
G
T
110300
A
C
G
T
122100
A
C
G
T
130300
A
C
G
T
141002
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 GGTTCCGCCCCGCCAGTATGCAAATGAGGT 30
GGCACTCCGACCAATGGCGCGCGCAGGGGC 60
GGGCTCAGCGCGCGCGGTCACGTTTTCCAC 90
TATGTGACAGCGGAGGGCGACGCGGCGGCA 120
GCGGCGCTACTGGGACTAGCGGCTCCGGGC 150
GGCTGCGGCGCAGGCCGAGCGCACCAAGTG 180
ACGG 184
PER2 (mouse)CLOCK_MOUSE/ARNTL_MOUSERS0153205
2 GAACACTCGGCTCCTTTAAGAGGTACCCCT 30
CTTGCCCCACACCCGCATCCGATAGCACGC 60
DBP (mouse)CLOCK_MOUSE/ARNTL_MOUSERS0153350
3 GCACGCGCAAAGCCATGTGCTTCCCCCTTC 30
DBP (mouse)CLOCK_MOUSE/ARNTL_MOUSERS0153349
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000885NoneCLOCK_MOUSE/ARNTL_MOUSETFe

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
There are no sites in this dataset.
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000510NoneARNTL_HUMANpleiades genes

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
There are no sites in this dataset.