Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for FOXO3_MOUSE
FOXO3_MOUSE
TFe
TFBS logo for FOXO3/STAT5_MOUSE
FOXO3/STAT5_MOUSE
TFe
TFBS logo for FOXO3_HUMAN
FOXO3_HUMAN
TFe
Overview

FOXO3a binds preferentially to the consensus FOXO recognition element (FHRE; also known as the daf-16 family member binding element), (G/C)(T/C)AAA(C/T)AA or TT(G/A)TTT(G/A)(G/C) [1], which has been found in the promoter regions of target genes, including BIM (BCL2L11) [2], ID1 [3], PUMA (BCL2 binding component 3, BBC3 or JFY1) [4], BTG1 (B-cell translocation gene 1) [5], CITED2 [6][7], SOD2 (superoxide dismutase 2 or MnSOD) [8], BCL6 (B-cell CLL/lymphoma 6) [9], ESR1 (estrogen receptor alpha) [10][11], and GADD45A (growth arrest and DNA-damage-inducible, alpha) [12] [13]. Like other FOXOs, FOXO3 is also known to bind the insulin response element (IRE), T(G/A)TTT(T/G)(G/T) core sequence, which is very similar to FHRE and can be found in genes such as IGFBP-1 [14] and G6Pase (glucose-6-phosphatase) [15]. Several FHREs/IREs are often found within one promoter sequence, suggesting the possibility of interaction between different FOXO molecules on a promoter [15][9][16][12][13][5][8][10][11].

References
  1. Huang H and Tindall DJ. Dynamic FoxO transcription factors. J. Cell. Sci., 120(Pt 15):2479-87. (PMID 17646672)
  2. Essafi A et al. Direct transcriptional regulation of Bim by FoxO3a mediates STI571-induced apoptosis in Bcr-Abl-expressing cells. Oncogene, 24(14):2317-29. (PMID 15688014)
  3. Birkenkamp KU et al. FOXO3a induces differentiation of Bcr-Abl-transformed cells through transcriptional down-regulation of Id1. J. Biol. Chem., 282(4):2211-20. (PMID 17132628)
  4. You H et al. FOXO3a-dependent regulation of Puma in response to cytokine/growth factor withdrawal. J. Exp. Med., 203(7):1657-63. (PMID 16801400)
  5. Bakker WJ et al. FoxO3a regulates erythroid differentiation and induces BTG1, an activator of protein arginine methyl transferase 1. J. Cell Biol., 164(2):175-84. (PMID 14734530)
  6. Bakker WJ et al. Differential regulation of Foxo3a target genes in erythropoiesis. Mol. Cell. Biol., 27(10):3839-3854. (PMID 17353275)
  7. Bakker WJ et al. FOXO3a is activated in response to hypoxic stress and inhibits HIF1-induced apoptosis via regulation of CITED2. Mol. Cell, 28(6):941-53. (PMID 18158893)
  8. Kops GJ et al. Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature, 419(6904):316-21. (PMID 12239572)
  1. Tang TT et al. The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor. J. Biol. Chem., 277(16):14255-65. (PMID 11777915)
  2. Guo S and Sonenshein GE. Forkhead box transcription factor FOXO3a regulates estrogen receptor alpha expression and is repressed by the Her-2/neu/phosphatidylinositol 3-kinase/Akt signaling pathway. Mol. Cell. Biol., 24(19):8681-90. (PMID 15367686)
  3. Madureira PA et al. The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. J. Biol. Chem., 281(35):25167-76. (PMID 16809346)
  4. Hollander MC et al. Analysis of the mammalian gadd45 gene and its response to DNA damage. J. Biol. Chem., 268(32):24385-93. (PMID 8226988)
  5. Tran H et al. DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein. Science, 296(5567):530-4. (PMID 11964479)
  6. Hall RK et al. Regulation of phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein-1 gene expression by insulin. The role of winged helix/forkhead proteins. J. Biol. Chem., 275(39):30169-75. (PMID 10913147)
  7. Onuma H et al. Correlation between FOXO1a (FKHR) and FOXO3a (FKHRL1) binding and the inhibition of basal glucose-6-phosphatase catalytic subunit gene transcription by insulin. Mol. Endocrinol., 20(11):2831-47. (PMID 16840535)
  8. Fernández de Mattos S et al. FoxO3a and BCR-ABL regulate cyclin D2 transcription through a STAT5/BCL6-dependent mechanism. Mol. Cell. Biol., 24(22):10058-71. (PMID 15509806)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
Pazar TFIDSpeciesTF NamePazar Project
TF0000812NoneFOXO3_HUMANTFe

LogoPFMSites
443_ENST00000343882_TF0000812.png
 ACGTA
A
  C
C
  G
G
  T
T
11108
A
C
G
T
23052
A
C
G
T
35203
A
C
G
T
42602
A
C
G
T
51036
A
C
G
T
60208
A
C
G
T
72503
A
C
G
T
80055
A
C
G
T
93160
A
C
G
T
102026
A
C
G
T
119100
A
C
G
T
1210000
A
C
G
T
139010
A
C
G
T
140820
A
C
G
T
159100
A
C
G
T
162521
A
C
G
T
171090
A
C
G
T
180631
A
C
G
T
192710
A
C
G
T
206400
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 CAGAGCGAGGCTGTGTCTCAAAAATAAATA 30
AATAATAAATTAAAAAAATAAGAGTATCTA 60
TAACCTGGTCCCAGCCTGAATTTCCTTTTT 90
CACCCCAACACGTAGCCCTAGTTACATTCT 120
TCTGACGTCTGTAAACAAGCCCAGCCCTTC 150
CTGTTGTGAAGCCAAGTTCAGGTGGTTCCT 180
CTTCGCCTGACTGTTTTCCCATTCCACTTA 210
CCGGAAGCCTAGTCATCCTTCGGAGGGCTG 240
TACGGGGGTTGCAAGAAGCAACGGAAACGG 270
TTCAGCACCTGCTACCTTCCATCATATTCT 300
TTTCAATAAAGGGGCAAC 318
SOD2 (human)FOXO3_HUMANRS0146172
2 TTCTTTCAGTTTCCCTCCTTTCCAACGACT 30
ACTTTGAGACAAGA 44
TNFSF10 (human)FOXO3_HUMANRS0146173
3 GATCAGGCTGTTTTTGTGTGCCTGTTTTGC 30
TATTTTACGTAA 42
G6PC (mouse)FOXO3_HUMANRS0146174
4 CAGAGGAGCCCAGTGCGGCCCTCGCCTCTA 30
CCCGCTGCCCTGCCCGGTGCCCTGCCACCG 60
ACCCACCCTTGCTGTTCTGAAACCCGGGTC 90
GTCTTTCCACACTGCGAGCAGGCACTAGAC 120
GAGCAGGAGGCTGGACCTAGGAGCGCGGGT 150
CACGCCCCCATGCCGCCCATTGGCTGCTTT 180
TGAACGTTCTGAGCCCGCCCCTCCGGGGGC 210
CGTGGCGTGTTTATAAAAGACAAGCTGTGG 240
CTCCGCACTCTCATTCCACGTTCTTAACTG 270
TTCCATTTTCCGTATCTGCTTCGGGCTTCC 300
ID1 (human)FOXO3_HUMANRS0146175
5 TGGCGTGTTTATAAAAGACAAGCTGTGGCT 30
ID1 (human)FOXO3_HUMANRS0146176
6 TCGCGAGGACCAACCCAGTCCCCGCGCCTG 30
CCCCAGAGCGGCTTAGAAACTCAGGGCACA 60
GTGAGAGCGCAGGGCGCCTCCCGAGGCTTC 90
ACACCGCCGGCCGGGCCAGCGGAGGCTGTG 120
ACCGGAGCGCCCCCTCTGTGCCGCGCACGC 150
CGCGGCCGCCGCCGGGTTGGGGTAGGTGAG 180
CGGGAGGCTAGGGTACACTTCGGGGTGGGG 210
GATGGGCGCGCACATGGCCGCCAGCAGGCA 240
GAGTTACTCCGGTAAACACGCCAGGGACGG 270
CGGCGCGCGCGGGAGGCAACCCAGCGGGGC 300
AACCCCCGCCTTTACCTGTCCGAGCCTGCA 330
CGCGCCGGCGGCCGCGGCGCCGAGGGGGGC 360
GGAGCTTGCCAGCCCGCGCGCCGGGGCGGG 390
ACCTAGCGGGGGCGGGGTCCGCAGTGATTG 420
GGCGTAGGAGCGG 433
BCL2L11 (human)FOXO3_HUMANRS0146177
7 CAGAGTTACTCCGGTAAACACGCCAGGGAC 30
BCL2L11 (human)FOXO3_HUMANRS0146178
8 AGGCACCACTGTCACCAACAAAGGGTAACA 30
GTCTTTCTTTTCAATATTTATTTATATCCA 60
GTATTTATTTTCAATACTGACTATGGAGAG 90
AGCTCTCCTGTGCTCAAACACTGCAATACT 120
GGGGGTCTTTCAAAGCACAAAAACATATAT 150
TTGCATGATGGCATCATTAACATTTTTATG 180
GCTTTCTATTTCTTTTTTGTACTGGTCTCA 210
AGAGCCACTCATAAATCTCTCAGTAACTGC 240
ATAGTGTCCCAGGGCCAGAGACCGGCCACT 270
CCTGGCATTGTGATTAGAGTCATTTAATAT 300
CCAAGGTGGTGACTAATGTCTGGCAACAAA 330
GCCTCCATTGGGTGTCATGT 350
ESR1 (human)FOXO3_HUMANRS0146179
9 CCACTGGGAAATGAGAGACCTCGTTCCCAA 30
TCACGGTCAGTGCAACTCGAAAGCCTAAAA 60
TCAGTTTAAAACAAAGGTATCTACCTTTAT 90
CTTATGTTCATATCCTAGGCTTTTAATAAT 120
ACGTATTTTTCACATGTTTACAGAAAGCAG 150
TCAACTGAGCTATTCATGGAAAGGTTTGTG 180
GGTTTGGTTAACGAAGTGGAGGAGTATTAC 210
ATTTCAGCTGGAAACACATCCCTAGAATGC 240
CAAAACATTTATTCCAAAGTCTGGTTTCCT 270
GGTGCAATCGGAGGCATGGCAATGCCTCTG 300
TTCAGAGACTGGGGGCTAGGGCCAGTAAGG 330
CATTTGATCCAC 342
ESR1 (human)FOXO3_HUMANRS0146180
10 GTAGTCCTCCCCAGGGTCATCCTATGTACA 30
CACTACGTATTTCTAGCCAACGAGGAGGGG 60
GAATCAAACAGAAAGAGAGACAAACAGAGA 90
TATATCGGAGTCTGGCACGGGGCACATAAG 120
GCAGCACATTAGAGAAAGCCGGCCCCTGGA 150
TCCGTCTTTCGCGTTTATTTTAAGCCCAGT 180
CTTCCCTGGGCCACCTTTAGCAGATCCTCG 210
TGC 213
ESR1 (human)FOXO3_HUMANRS0146181
11 ATTTTTCACATGTTTACAGAAAGCAGTCAA 30
CTGAG 35
ESR1 (human)FOXO3_HUMAN, FOXM1_HUMANRS0153202
12 CAATATTTATTTATATCCAGTATTTATTTT 30
CAATAC 36
ESR1 (human)FOXO3_HUMAN, FOXM1_HUMANRS0153201
13 GAGGAGGGGGAATCAAACAGAAAGAGAGAC 30
AAACAGAGATATATC 45
ESR1 (human)FOXM1_HUMAN, FOXO3_HUMANRS0153203
14 ATCGAGTTGTGCCTGGAGTGATGTTTAAGC 30
CAATGTCAGGGCAAGG 46
ESR1 (human)FOXM1_HUMAN, FOXO3_HUMANRS0153204
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000811NoneFOXO3_MOUSETFe

LogoPFMSites
443_ENSMUST00000105502_TF0000811.png
 ACGTA
A
  C
C
  G
G
  T
T
10023
A
C
G
T
20140
A
C
G
T
31004
A
C
G
T
45000
A
C
G
T
55000
A
C
G
T
65000
A
C
G
T
70500
A
C
G
T
85000
A
C
G
T
94100
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 GGAGCTTTCACACGCGCCTCCTTGGCTTCT 30
TTCTCCGCCCTCCACCGCTCCGGAGTCTCA 60
GGCTGCCACTCGGGGGGTTTATTTGTTTAC 90
AAGCAGATTACGTCAGCTCCTCCCTCTCAT 120
CCCGGCCTCTGGGCACGCCCCCTGGCGGCC 150
TTTCTCCCGCCCCCTCCAGCCCCGAATCTG 180
CCTGCGTCACAATGGTGCGATCTCCGGATT 210
GGCTGGCGTCCGCCCTCACGCCCCGGGTAC 240
GCCACTTCCTTTCCGCAG 258
BTG1 (mouse)FOXO3_MOUSERS0146168
2 GAAGGAAGCACCTGGGACTCAGGGCGCCCT 30
GTCTGGGCGCACAGGTGCCACAGCGGTCTG 60
GCGGGTTTGTTTACAAACAATGGGGTTCGG 90
GCTCGCCCGCGCCCCCTGGTGGCTAGTGAG 120
ACCTGGGAGGA 131
BBC3 (mouse)FOXO3_MOUSERS0146169
3 GGGCGGGTACATTCTGAGTGGAGGATGGGC 30
GAGCATGCAGCTGCCCGCAGGCCAAGACAC 60
TAGGGTAAACACGCCGGGGTGGGCGGCGCA 90
CGCAAACTGCAGGACAGCCGGCGGGGCCAC 120
CCTCCCCACTACCTGTCGCAGCCTG 145
BCL2L11 (mouse)FOXO3_MOUSERS0146170
4 AAGCAAAACAAACTTATTTTGAACAC 26
IGFBP1 (mouse)FOXO3_MOUSE, FOXO4_MOUSERS0146171
5 AAGTAAACAACTATGTAAACAA 22
Artificial constructCO0003461
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000810NoneFOXO3/STAT5_MOUSETFe

LogoPFMSites
443_ENSMUST00000105502_TF0000810.png
 ACGTA
A
  C
C
  G
G
  T
T
10002
A
C
G
T
20020
A
C
G
T
30020
A
C
G
T
42000
A
C
G
T
51001
A
C
G
T
60110
A
C
G
T
70002
A
C
G
T
80020
A
C
G
T
90020
A
C
G
T
100020
A
C
G
T
110110
A
C
G
T
122000
A
C
G
T
130200
A
C
G
T
140020
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 GCAAGTAACTGTGTATGTGCAAAAAGGTGG 30
ATCTGGGGACGAGGATCGCTGAGTTTGTTT 60
ACAGAGCAGAGACGCCTCAGCTCGGATGCC 90
AAAGCTACCAAGAGCTGCAAACGCAAACTT 120
AGCAGAAGCACACGTAC 137
CITED2 (human)FOXO3/STAT5_MOUSERS0146166
2 TTTATTTGCAAGTCAATGAGCCAAATGGGC 30
GATCGGGCTCGTTGTGCTTCGTTCTGCAAG 60
CAAGGTTATTATTATCACCGCCTATTGCTC 90
CACTGAACAATTTCACTGAAAAGGAAGACT 120
AGTAGCCGTGTGTGCGCGCACTGTGCCATA 150
CAGGACGTGCTGCTACGTGCCCACTTCCAA 180
AACGACTTTATTTACAAAGCGATTACCA 208
CITED2 (mouse)FOXO3/STAT5_MOUSERS0146167