Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for ZBTB16_HUMAN
ZBTB16_HUMAN
TFe
Overview
No annotation is available in this section for this article. The content below is taken from a related TF, ZBTB16 (Homo sapiens).

PLZF contains 9 carboxy-terminal C2H2 zinc fingers that contribute to sequence specific DNA binding. PLZF also interacts with several trancriptional repressor complexes that may play a role in DNA recruitment. PLZF has been shown to bind to several different target genes and in most cases binding occurs within the proximal promoter region centered around an AT-rich sequence of 8 nucleotides.

The predicted binding mode of the PLZF zinc finger regions were analyzed, exploited the fact that zinc fingers can make structurally conserved interactions with DNA. PLZF binding predictions reveal several possible modes of binding with a minimal 5'-TACTGTAC recognition sequence. Sequence analysis and structural considerations suggest that zinc fingers 5 to 8 are most typical DNA binding fingers in that they containing a canonical TGEKP linker, and zinc fingers 6 to 8 may account best for the minimal PLZF target site 5'-TACTGTAC specificity.

Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
Pazar TFIDSpeciesTF NamePazar Project
TF0000764NoneZBTB16_HUMANTFe

LogoPFMSites
414_ENST00000335953_TF0000764.png
 ACGTA
A
  C
C
  G
G
  T
T
10071
A
C
G
T
20053
A
C
G
T
31700
A
C
G
T
41700
A
C
G
T
50107
A
C
G
T
61142
A
C
G
T
70062
A
C
G
T
87010
A
C
G
T
90512
A
C
G
T
103131
A
C
G
T
110044
A
C
G
T
123302
A
C
G
T
138000
A
C
G
T
146002
A
C
G
T
150062
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 GCCTTACTGTACAGGACTCCCTTC 24
HOXB2 (mouse)ZBTB16_HUMANRS0145728
2 TGAATGGATATAAAGTGCTTAACA 24
MPL (human)ZBTB16_HUMAN, NUCLEAR EXTRACTT CELLSRS0145725
3 GGATCCCCACTTTAACACCCAAGTTTTCTA 30
CTGTTCACTAATCTGGCCATAAAATCTGTC 60
ATCAAGGGTTAGAGAGCTGTATTTCCTACA 90
GGACAGTCTGGGCTCTGGTTGTCTTAGGAG 120
ATCCTTGGATGCTGCAGCCAGCTGGAGTGC 150
CTGTTACAAAACTTGTGGAAGTGCCCATGC 180
TGCCGGGGAGAAGGCCCTCTCCCAGGCCTT 210
ACTGTACAGGACTCCCTTCCAGACAGTTAC 240
TATTTGGATTCTCCTCTGCTAACCACCATC 270
CAGGAAAATATATGCATACATTGTTTTGTT 300
TTAGCTAAGGTACACAACACCCTCTCTGGC 330
CGCTGGCCTAGTTAAGAGCAGTTTCCCAAG 360
AGCCTGCCTCTTTCTGTCCTTGCAACCACC 390
ACCTCCAGGTTTCCCTCCTTCCCCCCCCCT 420
CCCGCTTCCCGGCAAACTTCTCTGCCTTTT 450
TCTTTTCTTTCTTTCTTTAAATACTCACCA 480
CCACCCACGCGGACGTTACACTGACAGAAA 510
GTTTCTAGTTCCAGCTCTCCGCTGAGTTGC 540
CATTTCTCTGCTAAGCAGCCTTCTCCTCTA 570
GGCTAGGCGACAGAGAGCGAGGAGGGGGAG 600
GGGAGGCCAGAGCCGTGGGAGTTCTCCGGG 630
GCAAACTTTCCACCCAAGTTAGCGCCTTCC 660
CTCTGTCCCCATTTCCCATCTGTTTCCTAG 690
ATCT 694
HOXB2 (mouse)ZBTB16_HUMANRS0145724
4 GCCTTGAATGACGTCAAGGCCGCGAGCGCT 30
TT 32
CCNA2 (human)ZBTB16_HUMANRS0145722
5 CGTCCCAGAGCTAAAGGCTGGGCAACCC 28
CCNA2 (human)ZBTB16_HUMANRS0145721
6 CGTCGGGCCCTAAATCCTACCTCTCCCCGC 30
CCCGCGCAGGCGTTTTCTCCCGCCCCAGCC 60
AGTTTGTTTCTCCCTCCTGCCCCGCCCCTG 90
CTCAGTTTCCTTTGGTTTACCCTTCACTCG 120
CCTGCGACCCTGTCGCCTTGAATGACGTCA 150
AGGCCGCGAGCGCTTTCATTGGTCCATTTC 180
AATAGTCGCGGGATACTTGAACTGCAAGAA 210
CAGCCGCCGCTCCGGCGGGCTGCTCGCTGC 240
ATCTCTGGGCGTCTTTGGCTCGCCACGCTG 270
GGCAGTGCCTGCCTGCGCCTTTCGCAACCT 300
CCTC 304
CCNA2 (human)ZBTB16_HUMANRS0145720
7 GCAGTGAGAAGGGGAACCACATCTTGACAC 30
TTCCAGTCGAAGGAAGAGTGCGACTGCGCG 60
GCAGCAAAGACTACGCCTCCCAGCGTGCTT 90
TGCGGCGGGCCGGCCCGCTTTACCCAGAGT 120
CGCCCTGCCGCAATCGCGCGTCTTTCCACC 150
GAGGCCCCGGATGTAGATTCCCTCCCCCGT 180
TCAGTGGTCGTGGCCTCACAGCGACTCTAA 210
GACTTGGGGCTCTCTCATTGGCTGTAACTC 240
TTCCACTGGATTGGTAGCAAAAAAAGAGGC 270
GGTGCCCAAGGCGAAAGGCTCTGTGACTAC 300
AGCCAATCAGAATCGAGGCCGGGCTTTGGC 330
GGGAGGTGGGAACGCTGTGGCCATTCGGAT 360
TTGGCGCGAGCGCGGCTGGAGTTTGCTGCT 390
GCCGCTGTGCAGTTTGTT 408
CDC6 (human)ZBTB16_HUMANRS0145719
8 TCATGAGTGCCAGGACTAGACCTGGTACTA 30
GGAAGCAGCTGCATTGGATTTACCAGGCTT 60
TTCACTCTTGTATTTTACAGGGCTGGGACA 90
GGCCTGGACTGCAAGGAGGGGTCTTTGCAC 120
CATCTCTG 128
GS0014016 (human)ZBTB16_HUMANRS0145718