Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for RARA_HUMAN
RARA_HUMAN
RARE
TFBS logo for RXR/RAR_HUMAN
RXR/RAR_HUMAN
RARE
TFBS logo for RARA_MOUSE
RARA_MOUSE
NFIRegulome
TFBS logo for RARA_MOUSE
RARA_MOUSE
ABS
TFBS logo for RXR/RAR_MOUSE
RXR/RAR_MOUSE
RARE
TFBS logo for RARB/RXRA_HUMAN
RARB/RXRA_HUMAN
pleiades genes
Overview

RAR/RXR heterodimers bind RAREs, which are composed of direct repeats (DR) of the motif PuG(G/T)TCA, classically separated by 2 or 5 bp.[1] DR1 RAREs can also be bound by RAR/RXR heterodimers, but with an opposite polarity of the RAR and RXR monomers. [2] Everted repeats with 8 bp spacing have also been shown to function as RAREs.[3][4] Proximal promoters of several RAR target genes contain highly conserved RAREs (e.g. CYP26A1 and HOX genes). In addition, sites located at much greater distances (several kbp or tens of kbp from the transcriptional start site) can function as transcriptional enhancers.[5] Genome-wide chromatin binding sites of RARs have been characterized by chromatin immunoprecipitation assays in the MCF7 human breast cancer cell line and revealed extensive overlap with regions bound by estrogen receptor alpha, suggesting cross-talk between the transcriptional networks of these two families of nuclear receptors.[6][7]

References
  1. Mader S et al. The patterns of binding of RAR, RXR and TR homo- and heterodimers to direct repeats are dictated by the binding specificites of the DNA binding domains. EMBO J., 12(13):5029-41. (PMID 8262045)
  2. Zechel C et al. The dimerization interfaces formed between the DNA binding domains of RXR, RAR and TR determine the binding specificity and polarity of the full-length receptors to direct repeats. EMBO J., 13(6):1425-33. (PMID 8137826)
  3. Tini M et al. An everted repeat mediates retinoic acid induction of the gamma F-crystallin gene: evidence of a direct role for retinoids in lens development. Genes Dev., 7(2):295-307. (PMID 8436299)
  4. Tavera-Mendoza L et al. Convergence of vitamin D and retinoic acid signalling at a common hormone response element. EMBO Rep., 7(2):180-5. (PMID 16322758)
  1. Balmer JE and Blomhoff R. A robust characterization of retinoic acid response elements based on a comparison of sites in three species. J. Steroid Biochem. Mol. Biol., 96(5):347-54. (PMID 16081280)
  2. Hua S et al. Genomic antagonism between retinoic acid and estrogen signaling in breast cancer. Cell, 137(7):1259-71. (PMID 19563758)
  3. Ross-Innes CS et al. Cooperative interaction between retinoic acid receptor-alpha and estrogen receptor in breast cancer. Genes Dev., 24(2):171-82. (PMID 20080953)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
Preferred profile
Pazar TFIDSpeciesTF NamePazar Project
TF0000791NoneRXR/RAR_MOUSERARE

LogoPFMSites
337_ENSMUST00000068133_TF0000791.png
 ACGTA
A
  C
C
  G
G
  T
T
1220192
A
C
G
T
20111715
A
C
G
T
3520135
A
C
G
T
4171394
A
C
G
T
526584
A
C
G
T
6149200
A
C
G
T
734360
A
C
G
T
801384
A
C
G
T
9202714
A
C
G
T
1032533
A
C
G
T
1103823
A
C
G
T
1239202
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 AGTTCACCCAAAGTTCA 17
CYP26A1 (mouse)RARG_MOUSE, RXR/RAR_MOUSERS0145803
2 GGGTCAAGAGGTCA 14
EPO (mouse)RXR/RAR_MOUSERS0145850
3 GGGTCGTGACCC 12
CDX1 (mouse)RXR/RAR_MOUSERS0145851
4 GGGTCAAGAGTTCA 14
CDX1 (mouse)RXR/RAR_MOUSERS0145852
5 AGGGCAGAGGTCA 13
CRABP2 (mouse)RXR/RAR_MOUSERS0145853
6 AGTTCACCAGGTCA 14
CRABP2 (mouse)RXR/RAR_MOUSERS0145854
7 AGGTAAAAAGGTCA 14
HOXB1 (mouse)RXR/RAR_MOUSERS0145855
8 AGGGCAAGAGTTCA 14
HOXB1 (mouse)RXR/RAR_MOUSERS0145856
9 GGTTCATAGAGAGTTCA 17
HOXB1 (mouse)RXR/RAR_MOUSERS0145857
10 AGGTCAGGATCGGGGCA 17
MDK (mouse)RXR/RAR_MOUSERS0145858
11 GGGTCAAGGGCAGGCCT 17
PCK1 (mouse)RXR/RAR_MOUSERS0145859
12 CGGCCAAAGGTCA 13
PCK1 (mouse)RXR/RAR_MOUSERS0145860
13 GAGTCAAAGGTCA 13
RBP2 (mouse)RXR/RAR_MOUSERS0145861
14 AGTTCAACAGGTCT 14
RBP2 (mouse)RXR/RAR_MOUSERS0145862
15 AGGTCACAGTTCA 13
RBP2 (mouse)RXR/RAR_MOUSERS0145863
16 GGTTCACCGAAAGTTCA 17
HOXA1 (mouse)RXR/RAR_MOUSERS0145864
17 AGGTCATAAGGTCA 14
TLX2 (mouse)RXR/RAR_MOUSERS0145865
18 GGGTCAGCAGTTCA 14
FGF8 (mouse)RXR/RAR_MOUSERS0145866
19 AGGTGAAATGCAGGTCA 17
HOXD4 (mouse)RXR/RAR_MOUSERS0145867
20 GGTTCACCCAGAGGACA 17
HOXD4 (mouse)RXR/RAR_MOUSERS0145868
21 AGGTCGCGGCCAGGTCA 17
ADRB1 (mouse)RXR/RAR_MOUSERS0145869
22 AGTTCAGCAAGAGTTCA 17
RARA (mouse)RXR/RAR_MOUSERS0145814
23 GGGTCAGGAGGAGGTGA 17
RARG (mouse)RXR/RAR_MOUSERS0145816
24 GGTTGAAAGGTCA 13
RXRG (mouse)RXR/RAR_MOUSERS0145817
25 AGGTCATCGGCCT 13
NES (mouse)RXR/RAR_MOUSERS0145870
26 CGAGGATGAGGTCA 14
NES (mouse)RXR/RAR_MOUSERS0145871
27 AGTTCATGGAGAGGCCA 17
HOXB4 (mouse)RXR/RAR_MOUSERS0145872
28 AGGTGAACTTCAGGTCA 17
HOXA4 (mouse)RXR/RAR_MOUSERS0145873
29 GGATCACGCAGAGGTCA 17
HOXB5 (mouse)RXR/RAR_MOUSERS0145874
30 AGTTCAAGGATCA 13
APOA1 (mouse)RXR/RAR_MOUSERS0145875
31 GGATCAAGGGTTCA 14
APOA1 (mouse)RXR/RAR_MOUSERS0145876
32 AGTTTATGAGGCGTTTA 17
HOXA7 (mouse)RXR/RAR_MOUSERS0145877
33 AGTTCACAGAGATGTTA 17
ABCC2 (mouse)RXR/RAR_MOUSERS0145878
34 GGTTCACCGAAAGTTCA 17
RARB (mouse)RXR/RAR_MOUSERS0145815
35 GGGTGACCAAGCCTTCA 17
ETS1 (mouse)RXR/RAR_MOUSERS0145879
36 AGGTCAGGGGTTT 13
CRYAB (mouse)RXR/RAR_MOUSERS0145880
37 ATTTGGCAGGGTGACAC 17
CRYAB (mouse)RXR/RAR_MOUSERS0145881
38 TGGGCAGACTCAGGGCA 17
ALDH1A1 (mouse)RXR/RAR_MOUSERS0145882
39 GGTCCAGAGGGCA 13
APOC3 (mouse)RXR/RAR_MOUSERS0145883
40 TGGGCAAAGGTCA 13
APOC3 (mouse)RXR/RAR_MOUSERS0145884
41 AGGTCAGGGGGAGGGGA 17
FOXA1 (mouse)RARA_HUMAN, RXR/RAR_MOUSERS0145805
42 AGGTCAAAAGGTCA 14
RBP1 (mouse)RAR_HUMAN, RXR/RAR_MOUSERS0145808
43 GGGTCACAGGCGGGTCA 17
CYP26A1 (mouse)RARG_MOUSE, RXR/RAR_MOUSERS0145804
 
Other profiles
Pazar TFIDSpeciesTF NamePazar Project
TF0000154NoneRARB/RXRA_HUMANpleiades genes

LogoPFMSites
337_ENST00000330688_TF0000154.png
 ACGTA
A
  C
C
  G
G
  T
T
12001
A
C
G
T
20120
A
C
G
T
32100
A
C
G
T
43000
A
C
G
T
50030
A
C
G
T
60030
A
C
G
T
70003
A
C
G
T
80300
A
C
G
T
92001
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 GAACTGTGAGGGCCAGAAGGTCAGCAAGGG 30
TH (rat)RARB/RXRA_HUMANRS0000310
2 CCAAGAGACCTGCTG 15
OXT (rat)RARB/RXRA_HUMANRS0072142
3 AGGCGGTGACCTTGACCCCAGCCCA 25
OXT (rat)RARB/RXRA_HUMAN, WHOLE CELL EXTRACTNA, NUCLEAR EXTRACTHELA, NUCLEAR EXTRACTNARS0072751
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000792NoneRARA_HUMANRARE

LogoPFMSites
337_ENST00000254066_TF0000792.png
 ACGTA
A
  C
C
  G
G
  T
T
116000
A
C
G
T
200160
A
C
G
T
300160
A
C
G
T
400016
A
C
G
T
501600
A
C
G
T
616000
A
C
G
T
700160
A
C
G
T
800160
A
C
G
T
916000
A
C
G
T
1000160
A
C
G
T
1100016
A
C
G
T
1200016
A
C
G
T
1301600
A
C
G
T
1416000
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 AGGTCAGGAGTTCA 14
RAI1 (human)RARA_HUMANRS0145928
2 AGGTCAGGAGTTCA 14
RAI1 (human)RARA_HUMANRS0145929
3 AGGTCAGGAGTTCA 14
RAI1 (human)RARA_HUMANRS0145930
4 AGGTCAGGAGTTCA 14
GPRC5A (human)RARA_HUMANRS0145931
5 AGGTCAGGAGTTCA 14
GPRC5A (human)RARA_HUMANRS0145932
6 AGGTCAGGAGTTCA 14
GPRC5A (human)RARA_HUMANRS0145933
7 AGGTCAGGAGTTCA 14
RARRES1 (human)RARA_HUMANRS0145934
8 AGGTCAGGAGTTCA 14
RARRES1 (human)RARA_HUMANRS0145935
9 AGGTCAGGAGTTCA 14
RARRES1 (human)RARA_HUMANRS0145936
10 AGGTCAGGAGTTCA 14
RARRES3 (human)RARA_HUMANRS0145914
11 AGGTCAGGAGTTCA 14
RARRES3 (human)RARA_HUMANRS0145915
12 AGGTCAGGAGTTCA 14
RARRES3 (human)RARA_HUMANRS0145916
13 AGGTCAGGAGTTCA 14
SMYD5 (human)RARA_HUMANRS0145937
14 AGGTCAGGAGTTCA 14
SMYD5 (human)RARA_HUMANRS0145938
15 AGGTCAGGAGTTCA 14
SMYD5 (human)RARA_HUMANRS0145939
16 AGGTCAGGAGTTCA 14
SMYD5 (human)RARA_HUMANRS0145940
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000788NoneRXR/RAR_HUMANRARE

LogoPFMSites
337_ENST00000254066_TF0000788.png
 ACGTA
A
  C
C
  G
G
  T
T
1260220
A
C
G
T
2461523
A
C
G
T
3921144
A
C
G
T
41812135
A
C
G
T
5249123
A
C
G
T
6167232
A
C
G
T
737461
A
C
G
T
810434
A
C
G
T
9403113
A
C
G
T
1072435
A
C
G
T
1104341
A
C
G
T
1244220
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 TGACCCAGGGAGAAAGGTCA 20
CDKN2D (human)RXR/RAR_HUMANRS0145809
2 AGGTGAAATGCAGGTCA 17
HOXD4 (human)RXR/RAR_HUMANRS0145806
3 GGATCACGAGGTCAAGAGATCA 22
BTG2 (human)RXR/RAR_HUMAN, RARA_HUMANRS0145802
4 AGGTCAGGAGTTCA 14
CASP9 (human)RARA_HUMAN, RXR/RAR_HUMANRS0145810
5 GGGTCGAGAGGTCA 14
EPO (human)RXR/RAR_HUMANRS0145885
6 GGGTCACCCTGGGGTCA 17
PLAT (human)RXR/RAR_HUMANRS0145886
7 GGGTCGTGACCC 12
CDX1 (human)RXR/RAR_HUMANRS0145887
8 GGGTCAAGAGTTCA 14
CDX1 (human)RXR/RAR_HUMANRS0145888
9 AGGTCAGGAGGAGGTAG 17
CEBPE (human)RXR/RAR_HUMANRS0145889
10 AGGGCAGAGGTCA 13
CRABP2 (human)RXR/RAR_HUMANRS0145890
11 GGGTCATTGGAAGGACA 17
CRABP2 (human)RXR/RAR_HUMANRS0145891
12 GGTTCATAGAGAGTTCA 17
HOXB1 (human)RXR/RAR_HUMANRS0145892
13 AGGGCAAGAGTTCA 14
HOXB1 (human)RXR/RAR_HUMANRS0145893
14 AGGTAAAAAGGTCA 14
HOXB1 (human)RXR/RAR_HUMANRS0145894
15 AGGTCAGGAACCGGGCA 17
MDK (human)RXR/RAR_HUMANRS0145895
16 GGGTCAAGGACAAGGTT 17
PCK1 (human)RXR/RAR_HUMANRS0145896
17 CAGTCAAAGTTCA 13
PCK1 (human)RXR/RAR_HUMANRS0145897
18 GGGTCAAAAAGTCA 14
RBP1 (human)RXR/RAR_HUMANRS0145898
19 AGGTCAGGGGGAGGGGA 17
FOXA1 (human)RXR/RAR_HUMANRS0145899
20 GGTTCACCGAAAGTTCA 17
HOXA1 (human)RXR/RAR_HUMANRS0145900
21 AGGTCACAAGGTCA 14
TLX2 (human)RXR/RAR_HUMANRS0145901
22 GGGTCAGCAGTTCA 14
FGF8 (human)RXR/RAR_HUMANRS0145902
23 GGTTCATCCAGAGGACA 17
HOXD4 (human)RXR/RAR_HUMANRS0145807
24 AGGTCGCGGCCGGGTCA 17
ADRB1 (human)RXR/RAR_HUMANRS0145903
25 AGTTCAGCGAGAGTTCA 17
RARA (human)RXR/RAR_HUMANRS0145811
26 GGGTCAGGAGGAGGTGA 17
RARG (human)RXR/RAR_HUMANRS0145812
27 GGTTGAAAGGTCA 13
RXRG (human)RXR/RAR_HUMANRS0145813
28 AGGCCAATGACCT 13
NES (human)RXR/RAR_HUMANRS0145904
29 AGAGGATGAGGTCA 14
NES (human)RXR/RAR_HUMANRS0145905
30 AGTTCATGGAGAGGCCA 17
HOXB4 (human)RXR/RAR_HUMANRS0145906
31 GGGTCACAGGCGGGTCA 17
CYP26A1 (human)RXR/RAR_HUMANRS0145907
32 AGTTCACCCAAAGTTCA 17
CYP26A1 (human)RXR/RAR_HUMANRS0145908
33 AGGTGAACTTCAGGTCA 17
HOXA4 (human)RXR/RAR_HUMANRS0145909
34 GGATCATGCAGAGGTCA 17
HOXB5 (human)RXR/RAR_HUMANRS0145910
35 AGTTCAAGGATCA 13
APOA1 (human)RXR/RAR_HUMANRS0145911
36 GGGTCAAGGGTTCA 14
APOA1 (human)RXR/RAR_HUMANRS0145912
37 AGGGCAAATAGAGGTCA 17
RARRES3 (human)RXR/RAR_HUMANRS0145913
38 AGGTCAGGAGATCG 14
KRT18 (human)RXR/RAR_HUMANRS0145917
39 GGATCACGAGGTCA 14
KRT18 (human)RXR/RAR_HUMANRS0145918
40 AGGTCAGGAGTTCA 14
MPO (human)RXR/RAR_HUMANRS0145919
41 AGTTTATGAGGCGTTTA 17
HOXA7 (human)RXR/RAR_HUMANRS0145920
42 AGTTTATAGAAATGTGA 17
ABCC2 (human)RXR/RAR_HUMANRS0145921
43 ATGTCAGGGGTTT 13
CRYAB (human)RXR/RAR_HUMANRS0145922
44 ATTTGGCAATGTGACAC 17
CRYAB (human)RXR/RAR_HUMANRS0145923
45 GGGTGACCAAGCCCTCA 17
ETS1 (human)RXR/RAR_HUMANRS0145924
46 TGCTCTGAGTTTGTTCA 17
ALDH1A1 (human)RXR/RAR_HUMANRS0145925
47 GGTCCAGAGGGCA 13
APOC3 (human)RXR/RAR_HUMANRS0145926
48 TGGGCAAAGGTCA 13
APOC3 (human)RXR/RAR_HUMANRS0145927
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000870NoneRARA_MOUSENFIRegulome

LogoPFMSites
337_ENSMUST00000107475_TF0000870.png
 ACGTA
A
  C
C
  G
G
  T
T
10002
A
C
G
T
20020
A
C
G
T
32000
A
C
G
T
40200
A
C
G
T
50200
A
C
G
T
60002
A
C
G
T
70010
A
C
G
T
80010
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 TGACCTGGCT 10
REN1 (mouse)RARA_MOUSERS0146231
2 TGACCT 6
REN1 (mouse)RARA_MOUSERS0146232
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000450NoneRARA_MOUSEABS

LogoPFMSites
337_ENSMUST00000068133_TF0000450.png
 ACGTA
A
  C
C
  G
G
  T
T
10020
A
C
G
T
20002
A
C
G
T
30002
A
C
G
T
40200
A
C
G
T
52000
A
C
G
T
61100
A
C
G
T
70200
A
C
G
T
81010
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 AAGGGTTCACCGAAAGTTCA 20
GS0000899 (mouse)RARA_MOUSERS0001575
2 AGACCTGTTGAAC 13
GS0000907 (mouse)RARA_MOUSERS0001585
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000790NoneRAR_HUMANRARE

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
There are no sites in this dataset.
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000449NoneRARA_HUMANABS

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
  Sequence Gene TF or TF complex Pazar sequence
1 AGGGTTCACCGAAAGTTCACTCGC 24
GS0000897 (human)RARA_HUMANRS0001572
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000485NoneRARA_HUMANpleiades genes

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
There are no sites in this dataset.
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000299NoneRXR/RAR_HUMANpleiades genes

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
  Sequence Gene TF or TF complex Pazar sequence
1 AGAGGATGAGGTCATTGGCCT 21
NES (human)NR2F1 (COUP-TF)_HUMAN, RXRA_HUMAN, RXR/RAR_HUMANRS0000993
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000795NoneRARA_MOUSERARE

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
There are no sites in this dataset.
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000793NoneRARB_HUMANRARE

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
  Sequence Gene TF or TF complex Pazar sequence
1 GGTTCACCGAAAGTTCA 17
RARB (human)RARB_HUMAN, RXR/RAR_HUMANRS0145801
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000794NoneRARG_HUMANRARE

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
There are no sites in this dataset.
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000713NoneRARA/RXRA_MOUSEpleiades genes

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
  Sequence Gene TF or TF complex Pazar sequence
1 CTGTCCCCCAAGAGATAGTAGGTACTAGGA 30
TTTAGGGGCACTTCTGAGCCCCATTTCCCT 60
GGTAAGTGTCCCAACCCCCCAAATCAACCC 90
AAGCCTGGTCTCAATCTAGGACAGTGGTAG 120
AATGCTGTCCCTAGAGTCAGTACCATGTGA 150
AATTGTGCTGCAGGCAGGGGCCCCAGGCTG 180
GGAGGTGGGGGTTGGGGGAGTCAGGGGCAG 210
GTCAGGGAAGGAGACTCAGGTTTCATTTAG 240
AGAAATTCTGCAGACCCGTGAGGACTATGG 270
TGAGAGCAGAGA 282
PCP2 (mouse)RARA/RXRA_MOUSERS0145060
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000789NoneRAR_MOUSERARE

LogoPFMSites
MEME could not generate a logo for this dataset.
MEME could not find a motif in this dataset.
There are no sites in this dataset.