Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for NFIC_HUMAN
NFIC_HUMAN
NFIRegulome
TFBS logo for NFIC_HUMAN
NFIC_HUMAN
ABS
TFBS logo for NFIA_HUMAN
NFIA_HUMAN
pleiades genes
TFBS logo for NFIC (NF-I)_HUMAN
NFIC (NF-I)_HUMAN
ORegAnno
TFBS logo for NFIA_HUMAN
NFIA_HUMAN
NFIRegulome
TFBS logo for NFIA_HUMAN
NFIA_HUMAN
ABS
Overview
No annotation is available in this section for this article. The content below is taken from a related TF, NFIA (Homo sapiens).

The NFI binding site has been assessed by: 1) selection of sites from human genomic DNA [1], 2) Selection from libraries of degenerate oligonucleotides [2] and 3) mutagenesis of known sites. All give similar though not identical results and show that NFI proteins bind to a consensus sequence TTGGCN5GCCAA with affinity on the order of 10E-11M. Binding occurs to 1/2 sites (TTGGC or GCCAA) with an affinity on the order of 10E-8M and to random sequences at 10E-6M [3].

References
  1. Gronostajski RM. Roles of the NFI/CTF gene family in transcription and development. Gene, 249(1-2):31-45. (PMID 10831836)
  2. Roulet E et al. High-throughput SELEX SAGE method for quantitative modeling of transcription-factor binding sites. Nat. Biotechnol., 20(8):831-5. (PMID 12101405)
  1. Meisterernst M et al. A quantitative analysis of nuclear factor I/DNA interactions. Nucleic Acids Res., 16(10):4419-35. (PMID 3380685)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
Pazar TFIDSpeciesTF NamePazar Project
TF0000846NoneNFIC_HUMANNFIRegulome

LogoPFMSites
195_ENST00000443272_TF0000846.png
 ACGTA
A
  C
C
  G
G
  T
T
12001
A
C
G
T
20030
A
C
G
T
30111
A
C
G
T
40201
A
C
G
T
50120
A
C
G
T
63000
A
C
G
T
70030
A
C
G
T
80300
A
C
G
T
91200
A
C
G
T
103000
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 TGGAGTTGAGCCA 13
CYP17A1 (human)NFIC_HUMANRS0146267
2 TGGCTGGGCTCCA 13
CYP17A1 (human)NFIC_HUMANRS0146275
3 ACTGGCGAGCAATTGGA 17
TFAP2A (human)NFIC_HUMANRS0146243
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000861NoneNFIA_HUMANNFIRegulome

LogoPFMSites
195_ENST00000371191_TF0000861.png
 ACGTA
A
  C
C
  G
G
  T
T
120110
A
C
G
T
20940
A
C
G
T
39400
A
C
G
T
420102
A
C
G
T
521110
A
C
G
T
601112
A
C
G
T
78501
A
C
G
T
87231
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 GGTTTAGCTGTCTGTCCCT 19
CTLA4 (human)NFIA_HUMANRS0146329
2 GCCGCCCCCCAGGGCCTCCTC 21
GFAP (human)NFIA_HUMANRS0146310
3 GCACAGACACAA 12
GFAP (human)NFIA_HUMANRS0146311
4 TGGCTGGCTGCATGCCCTGTGGC 23
SERPINE1 (human)NFIA_HUMANRS0146264
5 TGTCAAGCCGCCAAC 15
ADA (human)NFIA_HUMANRS0146254
6 TGGGCTGCGGCCCA 14
GFAP (human)NFIA_HUMANRS0146308
7 TGGCAGCCCTGCCA 14
S100B (human)NFIA_HUMANRS0146276
8 TGGGCTGCACCAG 13
S100B (human)NFIA_HUMANRS0146278
9 TGGCTCC 7
SLC25A5 (human)NFIA_HUMANRS0146312
10 TTCCTGGC 8
SLC25A5 (human)NFIA_HUMANRS0146315
11 TGGAACTCGGCCA 13
CDKN1A (human)NFIA_HUMANRS0146291
12 GGCGACTGTCC 11
TP53 (human)NFIA_HUMANRS0146242
13 TTGGA 5
SCGB2A1 (human)NFIA_HUMANRS0146296
14 TGTCAGGGATCCAAATATTACTG 23
SCGB2A1 (human)NFIA_HUMANRS0146297
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000337NoneNFIA_HUMANABS

LogoPFMSites
195_ENST00000371185_TF0000337.png
 ACGTA
A
  C
C
  G
G
  T
T
10300
A
C
G
T
20300
A
C
G
T
30210
A
C
G
T
41011
A
C
G
T
50030
A
C
G
T
60300
A
C
G
T
70201
A
C
G
T
83000
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 TCCCTGCCAGAGGA 14
GS0000630 (human)NFIA_HUMANRS0001070
2 TAGCTGGGCTGCGGCCCAACCCCACCCCCT 30
C 31
GS0000821 (human)NFIA_HUMANRS0001437
3 CGGAGCCCGGGCCAA 15
GS0000944 (human)NFIA_HUMANRS0001639
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000231NoneNFIA_HUMANpleiades genes

LogoPFMSites
195_ENST00000371185_TF0000231.png
 ACGTA
A
  C
C
  G
G
  T
T
11900
A
C
G
T
23124
A
C
G
T
31009
A
C
G
T
400100
A
C
G
T
500100
A
C
G
T
63520
A
C
G
T
73151
A
C
G
T
83322
A
C
G
T
94402
A
C
G
T
100244
A
C
G
T
111072
A
C
G
T
122044
A
C
G
T
1301000
A
C
G
T
1401000
A
C
G
T
159001
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 ACTTGTCATGGCGACTGTCCAGCTTTGTGC 30
GS0000182 (human)NFIA_HUMANRS0000812
2 ACTTGTCATGGCGACTGTCCA 21
GS0000182 (human)NFIA_HUMANRS0000813
3 GATCCCTCAGTGGTCATTGGATGTCTGCCA 30
CGGGCAACCCCCTGCCTGCA 50
Artificial constructCO0003340
4 GATCTGGCACTGTGCCAAG 19
Artificial constructCO0003341
5 GTGGAAAAACCCAGGAAGCACAGTGGAAAA 30
ACATGTTTATGCCCTCAGGAAAAAACCCAG 60
GAACTGACTCAAT 73
GS0000484 (rat)NFIA_RAT, NFIA_HUMANRS0000817
6 GGAAGTGGAAACTGGCCAAAGGAGTGGAAA 30
Artificial constructCO0003342
7 GATCCCAACCTGCACTTGCATGACCTTGTC 30
TCGCTTGCCTCACCCTAAACCCAGCCTTGA 60
CACTCCAATTAAACTTTATTTACAAAACAA 90
GGGGGCCGGCCAGTAGGATGTAGTTTGCCC 120
ATACGACTTTTTTAAAGTATCGCATTGACT 150
ACTGTTTATCTCGATGACTGAAGGGTTCTT 180
TTGGCATCCCTGTAGCAAATGCGTCTCACC 210
CTAGTCCTGGTCCTGCTCCAAGGGTTTTTG 240
TCCAGGCACATCGTGACCTCACCCTTCCTC 270
CCCTCTCCGAGGCCTCTCTCAGGGTCCAGC 300
GTTCAAGTCCCG 312
SLC25A5 (human)NFIA_HUMANRS0000820
8 GCGTCTCACCCTAGTCCTGGTCCTGCTCCA 30
AGGGTTTTTGTCCAGGCACATCGTGACCTC 60
ACCCTTCCTCCCCTCTCCGAGGCCTCTCTC 90
AGGGTCCAGCGTTCAAGTCCCGGGTGTTCT 120
CTGGACCCGCCCCTTCC 137
SLC25A5 (human)NFIA_HUMANRS0000821
9 TGACCTTGTCTCGCTTGCCTCACCCTAAAC 30
CCAGCCTTGACACTCCAATTAAACTTTATT 60
TACAAAACAAGGGGGCCGGCCAGTAGGATG 90
TAGTTTGCCCATACGACTTTTTTAAAGTAT 120
CGCATTGACTACTGTTTATCTCGATGACTG 150
AAGGGTTCTTTTGGCATCCCTGTAGC 176
SLC25A5 (human)NFIA_HUMANRS0000822
10 TAATGGCCCAAGGCCAAGAGTTGA 24
CYP1A2 (human)NFIA_HUMAN, NFIA_RATRS0000823
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000542NoneNFIC (NF-I)_HUMANORegAnno

LogoPFMSites
195_ENST00000341919_TF0000542.png
 ACGTA
A
  C
C
  G
G
  T
T
10010
A
C
G
T
22000
A
C
G
T
30020
A
C
G
T
41010
A
C
G
T
50020
A
C
G
T
60110
A
C
G
T
70110
A
C
G
T
82000
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 TGGAGAGGGAGGC 13
PROC (human)NFIC (NF-I)_HUMANRS0001862
2 AGGGCCA 7
PROC (human)NFIC (NF-I)_HUMANRS0001863
 
Pazar TFIDSpeciesTF NamePazar Project
TF0000368NoneNFIC_HUMANABS

LogoPFMSites
195_ENST00000341919_TF0000368.png
 ACGTA
A
  C
C
  G
G
  T
T
11000
A
C
G
T
21000
A
C
G
T
30010
A
C
G
T
40500
A
C
G
T
50500
A
C
G
T
65000
A
C
G
T
74001
A
C
G
T
80001
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 CCAT 4
GS0000682 (human)NFIC_HUMANRS0001142
2 CCAA 4
GS0000735 (human)NFIC_HUMANRS0001237
3 CCAA 4
GS0000745 (human)NFIC_HUMANRS0001260
4 CCAA 4
GS0000779 (human)NFIC_HUMANRS0001348
5 AAGCCAATT 9
GS0000948 (human)NFIC_HUMANRS0001651