Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for ESR1_HUMAN
ESR1_HUMAN
pleiades genes
TFBS logo for ESTROGEN RECEPTOR ALPHA_HUMAN
ESTROGEN RECEPTOR ALPHA_HUMAN
ERalpha1_Stender
TFBS logo for ESR1_HUMAN
ESR1_HUMAN
ESR1_Cicatiello
Overview
No annotation is available in this section for this article. The content below is taken from a related TF, ESR1 (Homo sapiens).

Ligand-activated ESR1 binds specifically to DNA at estrogen-responsive elements (EREs) through its DNA binding domain and bring coactivators and corepressors to the transcription start site. The consensus ERE consists of two half-sites (aGGTCAnnnTGACCt) separated by a three-nucleotide spacer. However, many natural EREs deviate substantially from the consensus sequences[1].

References
  1. O'Lone R et al. Genomic targets of nuclear estrogen receptors. Mol. Endocrinol., 18(8):1859-75. (PMID 15031323)
    Binding site profiles
    About this section
    These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
    Pazar TFIDSpeciesTF NamePazar Project
    TF0001171NoneESR1_HUMANESR1_Grober_2011

    LogoPFMSites
    177_ENST00000473497_TF0001171.png
     ACGTA
    A
      C
    C
      G
    G
      T
    T
    19278120
    A
    C
    G
    T
    225016114
    A
    C
    G
    T
    313141685
    A
    C
    G
    T
    431484477
    A
    C
    G
    T
    50182135
    A
    C
    G
    T
    614911040
    A
    C
    G
    T
    7273113210
    A
    C
    G
    T
    863312311
    A
    C
    G
    T
    9203712221
    A
    C
    G
    T
    10265712105
    A
    C
    G
    T
    113470951
    A
    C
    G
    T
    12119312327
    A
    C
    G
    T
    1313174130
    A
    C
    G
    T
    144115504
    A
    C
    G
    T
    15107112107
    A
    C
    G
    T
    There are too many sites in this dataset to display. Please visit this project in Pazar to view the sites.
      Sequence Gene TF or TF complex Pazar sequence
     
    Pazar TFIDSpeciesTF NamePazar Project
    TF0001170NoneESR1_HUMANESR1_Cicatiello

    LogoPFMSites
    177_ENST00000473497_TF0001170.png
     ACGTA
    A
      C
    C
      G
    G
      T
    T
    113304720
    A
    C
    G
    T
    26017816
    A
    C
    G
    T
    37181741
    A
    C
    G
    T
    435165990
    A
    C
    G
    T
    515137480
    A
    C
    G
    T
    61810712
    A
    C
    G
    T
    7215210621
    A
    C
    G
    T
    829616743
    A
    C
    G
    T
    93097667
    A
    C
    G
    T
    108491097
    A
    C
    G
    T
    111921709
    A
    C
    G
    T
    There are too many sites in this dataset to display. Please visit this project in Pazar to view the sites.
      Sequence Gene TF or TF complex Pazar sequence
     
    Pazar TFIDSpeciesTF NamePazar Project
    TF0001134NoneESTROGEN RECEPTOR ALPHA_HUMANERalpha1_Stender

    LogoPFMSites
    177_ENST00000473497_TF0001134.png
     ACGTA
    A
      C
    C
      G
    G
      T
    T
    110367615
    A
    C
    G
    T
    217215328
    A
    C
    G
    T
    3701894
    A
    C
    G
    T
    46568121
    A
    C
    G
    T
    5019604
    A
    C
    G
    T
    61831115
    A
    C
    G
    T
    745249635
    A
    C
    G
    T
    832711744
    A
    C
    G
    T
    937171379
    A
    C
    G
    T
    10143021135
    A
    C
    G
    T
    1122351421
    A
    C
    G
    T
    12120291833
    A
    C
    G
    T
    1313167164
    A
    C
    G
    T
    1434138028
    A
    C
    G
    T
    1521592595
    A
    C
    G
    T
    There are too many sites in this dataset to display. Please visit this project in Pazar to view the sites.
      Sequence Gene TF or TF complex Pazar sequence
     
    Pazar TFIDSpeciesTF NamePazar Project
    TF0000189NoneESR1_HUMANpleiades genes

    LogoPFMSites
    177_ENST00000206249_TF0000189.png
     ACGTA
    A
      C
    C
      G
    G
      T
    T
    14090
    A
    C
    G
    T
    23361
    A
    C
    G
    T
    36007
    A
    C
    G
    T
    40760
    A
    C
    G
    T
    510201
    A
    C
    G
    T
    601021
    A
    C
    G
    T
    72911
    A
    C
    G
    T
    821010
    A
    C
    G
    T
    90328
    A
    C
    G
    T
    102290
    A
    C
    G
    T
    1112001
    A
    C
    G
    T
    1211200
    A
    C
    G
    T
    1311200
    A
    C
    G
    T
      Sequence Gene TF or TF complex Pazar sequence
    1 TTCATAGTAAGAGGTCAATATGTTTTCACA 30
    CTTGG 35
    CRH (human)ESR1_HUMANRS0000548
    2 TCAGAGACACCTGGTCAGGGAGGTTAGGAG 30
    AAGGG 35
    CRH (human)ESR1_HUMANRS0000549
    3 CCGGGTACCCCATGACCTCC 20
    GAL (human)NUCLEAR EXTRACTNA, ESR1_HUMANRS0000828
    4 TTCTATGACACACGTGAAACC 21
    CALB1 (mouse)ESR1_HUMANRS0001703
    5 TGAGTCTGAGCAAGGGATCCCCACCACCTG 30
    CTGCTTCCTAGACTCCAAAACTCCAGCTCC 60
    AGCTATTTCCTGGGAAGAGAGAAA 84
    CALB1 (mouse)ESR1_HUMANRS0001704
    6 AAGAAGGTTGGTGAGAGCAAGAGGCGGGAG 30
    CALB1 (mouse)ESR1_HUMANRS0001705
    7 GGTGACCTTGACCC 14
    OXT (rat)ESR1_HUMANRS0071837
    8 AGCTGAGGCGGTGACCTTGACCCCAGCCCA 30
    G 31
    OXT (rat)NR2F1 (COUP-TF)_HUMAN, NR2F1 (COUP-TF)_HUMAN, NR2F1 (COUP-TF)_HUMAN, ESR1_HUMANRS0118943
    9 GAACAGTTTGACCC 14
    OXT (rat)ESR1_HUMANRS0124432
    10 GGTGACCTTGACC 13
    OXT (human)ESR2_HUMAN, NCOA2 (TIF2)_HUMAN, NCOA3 (AIB1)_HUMAN, WHOLE CELL EXTRACTINSECT CELL LINE, ESR1_HUMANRS0144635
    11 CCTGCTCCCTTCCGCAAGGCACCTCACCTT 30
    CTGTGCCCAGACCATTAGCCAACGCGGTGA 60
    CCTTGACCCCGGCCCAGGCCCTGCTAATGA 90
    AGAGGAAAGCCCGTACGCACTCG 113
    OXT (human)ESR1_HUMAN, STF1_COW, NR2F1 (COUP-TF)_HUMANRS0144641
    12 ACCTTGACCCCGGCCCAGGCCCTGCTAATG 30
    AAGAGGAAAGCCCGTACGCACTCGGCCTGA 60
    CCCACGGCGACCCTCTGTGACCAATCATAC 90
    TACCAACCTCTTAAACAGAGCTCCACCGAC 120
    GCAATGCCCAGGCATAAAAAGGCCAGGCCG 150
    GAGAGACCGCCACCAGTCACGGACCCTGGA 180
    CCCAGCGCACCCGCACCATGGCCGGCCCCA 210
    GCCTCGCTTGC 221
    OXT (human) NUCLEAR EXTRACTMCF-7, ESR1_HUMAN, STF1_COW, NR2F1 (COUP-TF)_HUMAN, ESR2_RATRS0144642
    13 CTAGATTACCGGTGACCTTGACCCTACTCA 30
    Artificial constructCO0003375