Recently visited
Please sign in to see a list of articles you recently visited.
Recently updated
 SOX9
Homo sapiens
 HIF1A
Homo sapiens
 Pax6
Mus musculus
 PAX6
Homo sapiens
 Snai2
Mus musculus
 PPARA
Homo sapiens
 Ppara
Mus musculus
 Thrb
Mus musculus
 SNAI2
Homo sapiens
 Tbr1
Mus musculus
Transcription Factor Encyclopedia  BETA
Comments (post)
There are no comments posted here... Yet.
TFBS logos
TFBS logo for HOX11-CTF1
HOX11-CTF1
jaspar_core
Overview

The 60-amino acid homeodomain is a conserved DNA binding protein domain consisting of an N-terminal arm and three alpha helices that are separated by a loop and a turn. DNA binding of the homeodomain is mediated by the third recognition helix and the N-terminal arm with several conserved amino acids, including Arg3, Arg5, Ile47, Gln50 and Asn51, playing a major role in DNA recognition. Three of the residues, Arg5, Gln50 and Asn51, are conserved in the homeodomains of TLX gene family members whereas the two other residues are changed from Arg3 to Lys3 and Ile47 to Thr47. Since both Arg3 and Lys3 have side chains with amine groups this change likely does not affect DNA interactions. In contrast, Thr has both methyl and hydroxyl groups in its side chain while Ile contains only a hydrophobic methyl group, and thus, this amino acid change at position 47 may be associated with changes in the DNA recognition sequence from the TAATNN for canonical homeodomains to TLX1-specific consensus sequences.

Dear et al. (1993) showed that human TLX1 activated transcription of a reporter gene via a TAATGG target sequence. The homeodomain of TLX1 also bound not only to the canonical TAAT binding site recognized by prototypical class I homeodomain-containing proteins, but also bound to TAAC as well, suggesting that TAAC may represent a TLX1-unique recognition sequence[1]. Owens et al (2003) also reported association of TLX1 with a TAAC-type promoter, which was abolished when the threonine-47 residue unique to TLX family members was mutated to an isoleucine[2]. Tang and Breitman (1995) modelled more favourable interaction of the threonine-47 residue with guanine nucleotides, and suggested the TLX1 binding site as TAAGTG[3].

References
  1. Dear TN et al. The HOX11 gene encodes a DNA-binding nuclear transcription factor belonging to a distinct family of homeobox genes. Proc. Natl. Acad. Sci. U.S.A., 90(10):4431-5. (PMID 8099440)
  2. Owens BM et al. Specific homeodomain-DNA interactions are required for HOX11-mediated transformation. Blood, 101(12):4966-74. (PMID 12586625)
  1. Tang S and Breitman ML. The optimal binding sequence of the Hox11 protein contains a predicted recognition core motif. Nucleic Acids Res., 23(11):1928-35. (PMID 7596820)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
JASPAR profile
Pazar TFIDSpeciesTF NamePazar Project
TF0000083NoneHOX11-CTF1jaspar_core

LogoPFMSites
520_ENST00000370196_TF0000083.png
 ACGTA
A
  C
C
  G
G
  T
T
100016
A
C
G
T
200160
A
C
G
T
300160
A
C
G
T
401600
A
C
G
T
514101
A
C
G
T
62851
A
C
G
T
72842
A
C
G
T
87153
A
C
G
T
94327
A
C
G
T
1000160
A
C
G
T
1101600
A
C
G
T
1201600
A
C
G
T
1316000
A
C
G
T
1414011
A
C
G
T
  Sequence Gene TF or TF complex Pazar sequence
1 TGGCACCATGCCAAGGGTCC 20
Artificial constructCO0003102
2 TGGCAGCATGCCAAGATTCTA 21
Artificial constructCO0003103
3 TGGCACGTTGCCAATTCGC 19
Artificial constructCO0003104
4 TGGCACCACGCCAACACTG 19
Artificial constructCO0003105
5 CTGGCAACGTGCCAAGCTAG 20
Artificial constructCO0003106
6 ACTGGCATCTTGCCAATAG 19
Artificial constructCO0003107
7 TGGCAGGAAGCCAAAGCAG 19
Artificial constructCO0003108
8 CTGGCACAGAGCCAAGGTGT 20
Artificial constructCO0003109
9 CTGGCACCGTGCCATGGTGG 20
Artificial constructCO0003110
10 TTGGCAGCGGGCCAATAAT 19
Artificial constructCO0003111
11 CTGGCACTTGGCCAAGAAG 19
Artificial constructCO0003112
12 TCTTGGCAATAAGCCAAC 18
Artificial constructCO0003113
13 TGGCAGAACGCCAAGTAG 18
Artificial constructCO0003114
14 TGGCTCCAAGCCAAGAAG 18
Artificial constructCO0003115
15 TGGCACGGTGCCAGAAGC 18
Artificial constructCO0003116
16 TGGCCGGCCGCCAATGAGC 19
Artificial constructCO0003117